C Gbm A F Am G Bb Dm Gm] Chords for Rocket Rockers - Bersama Taklukan Dunia [LIVE at MUSICEGO] with song key, BPM, capo transposer, play along with guitar, piano, ukulele & mandolin.
BersamaTaklukan Dunia - Rocket Rockers C G Am G teringat kembali satu permainan F C Dm G yang Jump to. Sections of this page. Accessibility Help. Press alt + / to Gudang Chord Gitar Dan Lirik Lagu. Musician/Band. Update cord gitar terbaru disini. Song. Guitar Chords. Song. Solidaritas Mahasiswa Sumbawa Barat.
KunciGitar Dul Jaelani - Taklukan Dunia Chord Dasar Transpose: Auto Scroll Capo di fret 3 Intro : C .. C Ku tahu engkau menunggu Am Menantikan mimpimu F Bersabarlah kau cintaku C G Serahkan pada waktu.. C Berikanlah aku waktu Am Aku berjanji padamu Dm Akan ku raih mimpiku F G C Untukmu untukku cintaku.. Reff I: Dm F Ku masih menantikanmu..
Lpt9G. Ditulis oleh Jasmine pada Mar, 11 2021 Ditulis oleh Jasmine pada Mar, 11 2021 Original Artikel © // Taklukan Dunia" lagu ini bercerita tentang sebuah bersahabtan yang selamanya akan bersama menghadapi duniaC G Am Gteringat kembali satu permainanF C Dm Gyang sering dirimu dan aku mainkanC G Am Graihlah tanganku, genggam jabat eratF C Dm Gmenari bersama, tertawa ceriaAm Gdan ku kembali demi masa laluDm Gkawan sejati takkan pernah pergiReff C G Amjangan ragu kawanku tuk singgahi tempat iniF G Cmenyanyikan lagu kesenangan sepenuh hatiC G Amberdua kita lewati jalan yang terjal berlubangF G Cbersama kita taklukkan duniahari-hari bahagia, senyum lepas dan tawaobati luka lama yang menyiksait's okay tuk berbeda, jangan lelah mencobabuka mata, dengar rasaberpegangan terbang tinggi,tuk menyapa sang pelangigapai semua mimpi-mimpi,jangan tertidur kembaliAm Gdan ku kembali demi masa laluDm Gkawan sejati takkan pernah pergiReff C G Amjangan ragu kawanku tuk singgahi tempat iniF G Cmenyanyikan lagu kesenangan sepenuh hatiC G Amberdua kita lewati jalan yang terjal berlubangF G Cbersama kita taklukkan duniaReff C G Amjangan ragu kawanku tuk singgahi tempat iniF G Cmenyanyikan lagu kesenangan sepenuh hatiC G Amberdua kita lewati jalan yang terjal berlubangF G Cbersama kita taklukkan duniaLagu "Bersama Taklukan Dunia" dari Rocket Rockers ini dipublikasikan pada tanggal 21 Mei 2015Dokumen dari situs © chordquOriginal Artikel © //
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNNNNNNNNNNNNNNNNNNCNNNANNNNNFNNNNNNNNNNNBNNFNNNANNNNNCNNNNNNBNNNNNNGNNFNNNNNNNNNAmNNDNNNNNNBNNCNNNGNNNNNNNBNNNNGmNNNNNNNNNCNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNDmNNNNNNCNNFNNNNNNNNNNNNNNCNNNNNNNFNNNNNNNNNNNNNNNNNNNDmNNNNNNCNNFNNNNNNNNNNNNNNNNNNNNNNNNNNBNNNNNNNFNNNNBNNNNNNDmNNNNNNNFNNNNGmNNNNNNNNNNNNNGNNNNNNNNNCNNNNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNDmNNNNNNFNNNNNNNNNNNNNNNGNNNDNNBNNDmNNNCNNNNNFNNNNNNGNNNNNNBNNGNNCNNNGNNFNNNNNNGNNNNNBNNNNNNCNNNNNNBNNFNNNNNNNNNNNNNNNNNNNNNNBNNNNNNCNNDmNNNBNNNNNFNNNNNNNNNNNNNNCNNNNBNNNFNNNNNNNNNNNNNNNNNNNDmNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCFmCCCCCACFCCCCCCCCCCCCFCCCCCFCCCCCFCCCFCAmCCCFCCCCCGCCCACCCGCCCCCCCCCFCCCCCCCCCCCCCCCCCCCDmCACCCFCCCACFCCCCCCCFCCCCCACFCCCDmCCCCCFCCCCCCCCCACCFCCACCCFCCCCACCCCCCCCCCGCCCACCCCGmCCACCCCCACFCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCGCACFCCCCCFCCCCGCCACCCCCCCFCCCCCCGCACCCCCCCFCCCCGCCACCCCCCCFCCCGCCCACCCCCCCFCCCGCCCACCCCCCCFCCCGCCCCCACCCCCFCCCCGCCACCCCCCCCFCCCCFCACFCCCFCACFCCCCDmCCCCFCCCCCCCCCCCCFCCCCCCCCCCCCFCCCCCFCCDmCCCACCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
chord rocket rockers bersama taklukan dunia